View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11506_low_11 (Length: 224)
Name: NF11506_low_11
Description: NF11506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11506_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 46015003 - 46014806
Alignment:
| Q |
1 |
tttagaaatcaaggtagttttagaatcaagaatgatattcgaacaccttttattttaacacattcatcaagcatcttgnnnnnnnatctgtttctttctt |
100 |
Q |
| |
|
|||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46015003 |
tttaaaaatcaaagtagttttagaatcaacaatgatattcgaacaccttttattttaacacattcatcaagcatcttgtttttttatctgtttctttctt |
46014904 |
T |
 |
| Q |
101 |
tctttcaattgcatcgccaacatatcatatttatacaatttcaatttcnnnnnnncacaaggtgtcaaaaaataaattagtcttcattcaaaaataatga |
200 |
Q |
| |
|
|| ||||||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||| |||||| ||||| ||||| |
|
|
| T |
46014903 |
tc-------tgcatcgccgacatatcatatgtatacaatttcaatttctttttttcacaaggtgtcaaaaaataatttagttttcatttaaaaa-aatga |
46014812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University