View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11507_high_10 (Length: 240)

Name: NF11507_high_10
Description: NF11507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11507_high_10
NF11507_high_10
[»] chr1 (1 HSPs)
chr1 (18-240)||(32096366-32096588)


Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 32096588 - 32096366
Alignment:
18 gtaaccgtcagatagagattgaacaacaaagtaggagtggtgtaacggttttggtgggtccaacagataagaaaaaggtgaggattgtggaagagtgtgg 117  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32096588 gtaaccgtcagatagagactgaacaacaaagtaggagtggtgtaacggttttggtgggtccaacagataagaaaaaggtgaggattgtggaagagtgtgg 32096489  T
118 agccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtgatgctttgttggagattgagtgtttgcataga 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32096488 agccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtgatgctttgttggagattgagtgtttgcataga 32096389  T
218 gaaggattgttgcttgatgttat 240  Q
    ||||||||||||||||| |||||    
32096388 gaaggattgttgcttgacgttat 32096366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University