View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11507_low_11 (Length: 240)
Name: NF11507_low_11
Description: NF11507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11507_low_11 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 32096588 - 32096366
Alignment:
| Q |
18 |
gtaaccgtcagatagagattgaacaacaaagtaggagtggtgtaacggttttggtgggtccaacagataagaaaaaggtgaggattgtggaagagtgtgg |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096588 |
gtaaccgtcagatagagactgaacaacaaagtaggagtggtgtaacggttttggtgggtccaacagataagaaaaaggtgaggattgtggaagagtgtgg |
32096489 |
T |
|
| Q |
118 |
agccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtgatgctttgttggagattgagtgtttgcataga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32096488 |
agccacgagagcgaaagcagttgagacggaggttgtttcgtcggttcaggtttcgattattgagagtgatgctttgttggagattgagtgtttgcataga |
32096389 |
T |
|
| Q |
218 |
gaaggattgttgcttgatgttat |
240 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
32096388 |
gaaggattgttgcttgacgttat |
32096366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University