View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11507_low_13 (Length: 238)
Name: NF11507_low_13
Description: NF11507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11507_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 2753758 - 2753980
Alignment:
| Q |
1 |
aactctattgattcaaacaaaatttgttttcttgatatgtccccatcatttaatcttttccctataaacatttttgttacatgactacatgttcaaacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2753758 |
aactctattgattcaaacaaaatttgttttcttgatatgtccccatcatttaatcttttccctataaacatttttgttacatgactacatgttcaaacag |
2753857 |
T |
|
| Q |
101 |
actcatcatttttagggacaatggcattgttttctggggcaggtcctcttctgaacatcgaccctaactgaatgttagtacttccgccgttatgagaact |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||| |
|
|
| T |
2753858 |
actcatcatttttagggacaaaggcattgttttctggggcaggtcctcttctgaacatcgaccctagctgaatgttagtacttccaccattatgagaact |
2753957 |
T |
|
| Q |
201 |
tccctggacagaatggttgctat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2753958 |
tccctggacagaatggttgctat |
2753980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 177
Target Start/End: Original strand, 2745350 - 2745441
Alignment:
| Q |
86 |
tacatgttcaaacagactcatcatttttagggacaatggcattgttttctggggcaggtcctcttctgaacatcgaccctaactgaatgtta |
177 |
Q |
| |
|
|||||||||| ||||||| | || |||||||||||||| |||| |||||| |||||| | ||||| |||| || ||||||||||||||| |
|
|
| T |
2745350 |
tacatgttcatacagactgttgatctttagggacaatggtgttgtcttctggagcaggtgcccttctaaacacagatcctaactgaatgtta |
2745441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University