View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11507_low_16 (Length: 221)
Name: NF11507_low_16
Description: NF11507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11507_low_16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32095863 - 32096088
Alignment:
| Q |
1 |
catatcttccaaatgttgtttattaattactactagacttcacttcctagggtcatggcttgagatgatatatatgtacatattaagccaatgta----- |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32095863 |
catatcttccaaatgttgtttattaattactactagacttcacttcctagggtcatggcttgagatgatatatatgtacatattaagccaatgtatacga |
32095962 |
T |
|
| Q |
96 |
gatgccaaaatcataatcattacctgtttagatttacagtgagattgacataatcattctggttttggcaaagtcaccgttgatccaaatatatatttgg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
32095963 |
gatgccaaaatcataatcattacctgtttagattcacagtgagattgacataatcattctgattttggcaaattcaccgttgattcaaacatatatttgg |
32096062 |
T |
|
| Q |
196 |
attaacaataagtttgacagaatcac |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32096063 |
attaacaataagtttgacagaatcac |
32096088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University