View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11507_low_6 (Length: 360)

Name: NF11507_low_6
Description: NF11507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11507_low_6
NF11507_low_6
[»] chr7 (1 HSPs)
chr7 (83-203)||(18021464-18021584)


Alignment Details
Target: chr7 (Bit Score: 109; Significance: 9e-55; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 83 - 203
Target Start/End: Complemental strand, 18021584 - 18021464
Alignment:
83 tattcattatcgcatttcactattctttctttgcgatagctagttaggggtaattttgagaaaacaatatttaatatattttgaactttgaaaatgacaa 182  Q
    ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18021584 tattcattatcgcatttcactattctttctttgcgataggtggttaggggtaattttgagaaaacaatatttaatatattttgaactttgaaaatgacaa 18021485  T
183 ttagaaaagaacaaaaatatt 203  Q
    ||| |||||||||||||||||    
18021484 ttaaaaaagaacaaaaatatt 18021464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University