View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11508_high_10 (Length: 206)
Name: NF11508_high_10
Description: NF11508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11508_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 29574689 - 29574512
Alignment:
| Q |
18 |
actataaagttgtggtgattgagtagcagcatctcatagcgcactcactcgcacactgtgctcctttctcttttcaacgcaacctagaatccctcatgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29574689 |
actataaagttgtggtgattgagtagcagcatctcatagcgcactcactcgcacactgtgctcctttctcttttcaacgcaacctagaatccctcatgac |
29574590 |
T |
 |
| Q |
118 |
gacgtcgttcgccgcagcggcgctcagagaccccaaacttcagatccctacctaccatggcttccgttcttcttcatc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29574589 |
gacgtcgttcgccgcagcggcgctcagagaccccaaacttcagatccctacctaccatggcttccgttcttcttcatc |
29574512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University