View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11508_high_9 (Length: 213)

Name: NF11508_high_9
Description: NF11508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11508_high_9
NF11508_high_9
[»] chr8 (1 HSPs)
chr8 (15-167)||(34332969-34333121)


Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 167
Target Start/End: Complemental strand, 34333121 - 34332969
Alignment:
15 agaagaaaagtaggggcacatagttacggaaagaaatgtgatctatgaaagagatagggaaatttctaaggtgggatggagttggtgatgagggtttgat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34333121 agaagaaaagtaggggcacatagttacggaaagaaatgtgatctatgaaagagatagggaaatttctaaggtgggatggagttggtgatgagggtttgat 34333022  T
115 aaattctcttgatattatttccatttccatatatctcactttctgttcctttg 167  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
34333021 aaattctcttgatattatttccatttccatatatctcactttctgttcctttg 34332969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University