View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11508_low_10 (Length: 206)

Name: NF11508_low_10
Description: NF11508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11508_low_10
NF11508_low_10
[»] chr4 (1 HSPs)
chr4 (18-195)||(29574512-29574689)


Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 18 - 195
Target Start/End: Complemental strand, 29574689 - 29574512
Alignment:
18 actataaagttgtggtgattgagtagcagcatctcatagcgcactcactcgcacactgtgctcctttctcttttcaacgcaacctagaatccctcatgac 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29574689 actataaagttgtggtgattgagtagcagcatctcatagcgcactcactcgcacactgtgctcctttctcttttcaacgcaacctagaatccctcatgac 29574590  T
118 gacgtcgttcgccgcagcggcgctcagagaccccaaacttcagatccctacctaccatggcttccgttcttcttcatc 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29574589 gacgtcgttcgccgcagcggcgctcagagaccccaaacttcagatccctacctaccatggcttccgttcttcttcatc 29574512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University