View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11508_low_3 (Length: 396)
Name: NF11508_low_3
Description: NF11508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11508_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 28 - 377
Target Start/End: Complemental strand, 32539581 - 32539232
Alignment:
| Q |
28 |
agcagagagatgagaatttggtattccacatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctcaattgaattcctc |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539581 |
agcagagagatgagaatttggtattccgcatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctcaattgaattcctc |
32539482 |
T |
|
| Q |
128 |
aaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcagtttcatcttcacaagaatctcactctcat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32539481 |
aaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcaatttcatcttcacaagaatctcactctcat |
32539382 |
T |
|
| Q |
228 |
tatcatatgattctgaactgttttttcttctgaccaagtaagaatgacacttctcaaagattgttttcctgaaaaaattgtcttttatatatctttcaac |
327 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539381 |
tatcacatgattctgaactgttttttcttctgaccaagtaagaatgacacttctcaaagattgttttcctgaaaaaattgtcttttatatatctttcaac |
32539282 |
T |
|
| Q |
328 |
gtagtcactgaggatactaaccaatgctctgattgcaacttcgttcaaag |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539281 |
gtagtcactgaggatactaaccaatgctctgattgcaacttcgttcaaag |
32539232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University