View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11509_high_20 (Length: 277)
Name: NF11509_high_20
Description: NF11509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11509_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 7196945 - 7196862
Alignment:
| Q |
19 |
gttgaaaaggtccgctaacaatgattatcttcccgctcaaaattgttgatttagacaacaacatttgaagaggtgtcctcttaa |
102 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7196945 |
gttgaaaaggtccgctaacactgattatcttccagctcaaaattgttgatttagacaacaacatttgaagaggtgtcctcttaa |
7196862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 197 - 257
Target Start/End: Complemental strand, 7196720 - 7196661
Alignment:
| Q |
197 |
taacttgtcttcttggggctacatttatgttcatgttcatgcaagatcatattatagttta |
257 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7196720 |
taacttgtcttcttggg-ctacatttatgttcatgtgcatgcaagatcatattatagttta |
7196661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University