View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11509_low_18 (Length: 326)
Name: NF11509_low_18
Description: NF11509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11509_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 29106099 - 29105789
Alignment:
| Q |
1 |
attgggagcatctcatccaagagcagcaaaattctcacttgtggttgcagtgattacatcatttgcccttggtctcattctttcaatgattttaataata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29106099 |
attgggagcatctcatccaagagcagcaaaattctcacttgtggttgcagtgattacatcatttgcccttggtctcattctttcaatgattttaataatc |
29106000 |
T |
|
| Q |
101 |
ttccgaaaacagtatccagtattattctcaaatgatccagaagtgagagaggtagtgattgaattgacaccaatgttggcattatgcattgtcatcaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29105999 |
ttccgaaaacagtatccagtattattctcaaatgatccagaagtgagagaggtagtgattgaattgacaccaatgttggcattatgcattgtcatcaaca |
29105900 |
T |
|
| Q |
201 |
acattcagccagttctttcaggtgttgccattggtgctgggtggcaatcagctgttgcttatgtaaatattgcatgttactatctctttggtattccttt |
300 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29105899 |
acattcagcctgttctttcaggtgttgccattggtgctgggtggcaatcagctgttgcttatgtaaatattgcatgttactatctctttggtattccttt |
29105800 |
T |
|
| Q |
301 |
gggtctcttct |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
29105799 |
gggtctcttct |
29105789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University