View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11509_low_34 (Length: 236)
Name: NF11509_low_34
Description: NF11509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11509_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 62 - 120
Target Start/End: Original strand, 42896723 - 42896781
Alignment:
| Q |
62 |
tatacacaaaagtttattatggccaaaaatttgagttcacttaaaagcaaaatataatg |
120 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42896723 |
tatacacaaaattttattatggccaaaaatttgagttcacttaaaagcaaaatataatg |
42896781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University