View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11509_low_35 (Length: 220)

Name: NF11509_low_35
Description: NF11509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11509_low_35
NF11509_low_35
[»] chr1 (2 HSPs)
chr1 (113-176)||(46268274-46268337)
chr1 (172-206)||(46268527-46268561)


Alignment Details
Target: chr1 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 113 - 176
Target Start/End: Original strand, 46268274 - 46268337
Alignment:
113 gtgatttctccatcttcatcttcatgaccaagctcatcatgagacgatggagcaaacgcacaca 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
46268274 gtgatttctccatcttcatcttcatgaccaagctcatcatgagacgatggagcaaacacacaca 46268337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 206
Target Start/End: Original strand, 46268527 - 46268561
Alignment:
172 acacaaaaatccccatggacccgcaagagaagaaa 206  Q
    ||||||||||||| |||||||||||||||||||||    
46268527 acacaaaaatccctatggacccgcaagagaagaaa 46268561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University