View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_high_27 (Length: 378)
Name: NF1150_high_27
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 7e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 159 - 284
Target Start/End: Complemental strand, 39241582 - 39241457
Alignment:
| Q |
159 |
tgaattgatttgtatcaatttatttatgattgtgtgagacaggatgagaattggagcaaatgggttttatgcaaagtttatgaaaaggaaaagaagatgt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39241582 |
tgaattgatttgtatcaatttatttatgattgtgtgagacaggatgagaattggagcaaatgggttttatgcaaagtttatgaaaaggaaaagaagatgt |
39241483 |
T |
 |
| Q |
259 |
cacaagaaggtgcaagctgttgttat |
284 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
39241482 |
cacaagaaggtgcaagctgttgttat |
39241457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 13 - 99
Target Start/End: Complemental strand, 39241723 - 39241637
Alignment:
| Q |
13 |
aatatcatatttcctcatctccggtaagtgattgtgttttgttttgttgactacctatttatacatcacaacaaattacttattaag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39241723 |
aatatcatatttcctcatctccggtaagtgattgtgttttgttttgttgactacctatttataaatcacaacaaattacttattaag |
39241637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University