View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_high_33 (Length: 324)
Name: NF1150_high_33
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_high_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 101 - 283
Target Start/End: Complemental strand, 489683 - 489501
Alignment:
| Q |
101 |
gtgttaattgtgaatcgcagaaaataatggtttattcaaacttcgttatgctacagtgttatagtgcttatatagctgctatatatttgacaacacttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
489683 |
gtgttaattgtgaatcgcagaaaataatggtttattcaaacttcgttatgctatagtgttatagtgctgatatagctgctatatatttgacaacacttta |
489584 |
T |
|
| Q |
201 |
tactaacaagtatattgcggaacaataatgatttgatcaaattatgtgtcgtagcaactattctaccgactttgaacatctct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
489583 |
tactaacaagtatattgcggaacaataatgatttgatcaaattatgtgtcgtagcaactattctaccgactttgaacatctct |
489501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 58 - 93
Target Start/End: Complemental strand, 489733 - 489698
Alignment:
| Q |
58 |
cagttaaacacaccaagaactccggtgtactgttat |
93 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
489733 |
cagttaaacacaccaagaactccagtgtactgttat |
489698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 184 - 243
Target Start/End: Complemental strand, 24769368 - 24769309
Alignment:
| Q |
184 |
tatttgacaacactttatactaacaagtatattgcggaacaataatgatttgatcaaatt |
243 |
Q |
| |
|
|||||||||| ||||| |||||| ||| |||||| |||||||||||||||| ||||||| |
|
|
| T |
24769368 |
tatttgacaatactttgtactaaatagtgtattgcagaacaataatgatttgttcaaatt |
24769309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 184 - 235
Target Start/End: Original strand, 50402655 - 50402706
Alignment:
| Q |
184 |
tatttgacaacactttatactaacaagtatattgcggaacaataatgatttg |
235 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
50402655 |
tatttgacaacactttatactaaatagcatattgcggaacaatagtgatttg |
50402706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University