View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_high_44 (Length: 251)
Name: NF1150_high_44
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 48 - 241
Target Start/End: Complemental strand, 53038168 - 53037986
Alignment:
| Q |
48 |
gttaaatcatatctgtggggaagcaattcaattcatacattatacttttatgacaatgac----atcaaacaagattacaaggcaacacacatatgctta |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53038168 |
gttaaatcatatctgtggggaagcaattcaattcatacattatacttttatcacaatgacatcgatcaaacaagattacaaggcaacacacatatgctta |
53038069 |
T |
|
| Q |
144 |
tgaaatgaatattggtttccttataccaacattgctacatataattcaattaaattttatacttattttgtttaggttatttgtaaagtctagtatta |
241 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
53038068 |
tgaaatgaatatt---------------acattgctacatataattcaattaaattttatacttattttgtttaggttatttataaagtctagaatta |
53037986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 53038240 - 53038206
Alignment:
| Q |
1 |
tttttagacatgggtgataacattgaaaaccgatc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
53038240 |
tttttagacatgggtgataacattgaaaaccgatc |
53038206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University