View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_high_47 (Length: 248)
Name: NF1150_high_47
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_high_47 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 9 - 248
Target Start/End: Original strand, 46942025 - 46942264
Alignment:
| Q |
9 |
agcataggatggacttctgcttccatacatgtggggtggggaaggatacggtggaagagcagctgggtattgcccgtgtgatggagatctaacaaatgta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46942025 |
agcataggatggacttctgcttccatacatgtggggtggggaaggatacagtggaagagcagctgggtattgcccgtgtgatggagatctaacaaatgta |
46942124 |
T |
 |
| Q |
109 |
ggagcggcagggaaagatgatacatatgcattagtcaaacgtccagctttagcaggtggcattggacctccattgctgttgcttgctcgtgttcttttat |
208 |
Q |
| |
|
| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46942125 |
gaagcggcagggaaagatgatacatatgcattggtcaaacgtccagctttagcaggtggcattggacctccattgctgttgcttgctcgtgttcttttat |
46942224 |
T |
 |
| Q |
209 |
tggcagggaccacaatctgttttctcttctcaggcttaac |
248 |
Q |
| |
|
|||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
46942225 |
tggcagggacaacaatctgtttccttttctcaggcttaac |
46942264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University