View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_high_52 (Length: 215)
Name: NF1150_high_52
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_high_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 20 - 190
Target Start/End: Original strand, 6026174 - 6026344
Alignment:
| Q |
20 |
atagggtcaagtccaccaagctgtgagcataaatgttatggttgttttccatgtgaagctactcaagtaccaagcagaacaagccatttggggattatgt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6026174 |
atagggtcaagtccaccaagctgtgagcataaatgctatgattgttttccatgtgaagctactcaagtgccaagcagaacaagccatttggggattatgt |
6026273 |
T |
 |
| Q |
120 |
atgcaaattatgagcctgagagttggaaatgcaagtgtggtccttcattctatagtccttgaatattgtat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6026274 |
atgcaaattatgagcctgagagttggaaatgcaagtgtggtccttcattctatagtccttgaatattgtat |
6026344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 118 - 177
Target Start/End: Original strand, 42824276 - 42824335
Alignment:
| Q |
118 |
gtatgcaaattatgagcctgagagttggaaatgcaagtgtggtccttcattctatagtcc |
177 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
42824276 |
gtatgcaaattatgagcctgaaagctggaaatgcaaatgtggtccttccttctacagtcc |
42824335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 93
Target Start/End: Original strand, 42824166 - 42824239
Alignment:
| Q |
20 |
atagggtcaagtccaccaagctgtgagcataaatgttatggttgttttccatgtgaagctactcaagtaccaag |
93 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||| || |||||||||||| | |||||| ||||| |
|
|
| T |
42824166 |
atagggtcaagtccaccaagctgtgagcacaagtgttatggatgcaatccatgtgaagccattcaagttccaag |
42824239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University