View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1150_high_55 (Length: 207)

Name: NF1150_high_55
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1150_high_55
NF1150_high_55
[»] chr4 (1 HSPs)
chr4 (44-188)||(53038206-53038350)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 44 - 188
Target Start/End: Original strand, 53038206 - 53038350
Alignment:
44 gatcggttttcaatgttatcacccatgtctnnnnnnngtaaacggccattttgagtcttaaccaaaatgctcattttgtggactggtaccacctcttcta 143  Q
    ||||||||||||||||||||||||||||||       ||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53038206 gatcggttttcaatgttatcacccatgtctaaaaaaagtaaacaaccattttgagtcttaaccaaaatgctcattttgtggactggtaccacctcttcta 53038305  T
144 ataagagttggaatgaaatacatgaacatttgtcgaagtcccaga 188  Q
    |||||||||||||| ||||||||||||||||||||||||||||||    
53038306 ataagagttggaatcaaatacatgaacatttgtcgaagtcccaga 53038350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University