View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_low_14 (Length: 510)
Name: NF1150_low_14
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 291 - 481
Target Start/End: Original strand, 28675212 - 28675402
Alignment:
| Q |
291 |
cgctgaatcttcaggttctttgaaaaatctcaactttgaaactgaaacagactcactctgtttctcctcagagggttgctctgtttcttcattccttaaa |
390 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675212 |
cgctgaatcttcaagttctttgaaaaatctcaactttgaaactgaaacagactcactctgtttctcctcagagggttgctctgtttcttcattccttaaa |
28675311 |
T |
 |
| Q |
391 |
ggagaaccccaaaacctacttgctagtgaagatgaactatatggtgctgatttgcatctagttagtaacaaagcattttttggtggagtag |
481 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675312 |
ggagaaccccaaaacctacttgctagtgaagatgaactatatggtgctgatttgcatctagttagtaacaaagcattttttggtggagtag |
28675402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 125 - 226
Target Start/End: Original strand, 28675046 - 28675147
Alignment:
| Q |
125 |
ccatgtaaagaagaaggtatctgcaaaaacctttggatcaagattttcctgctcgttcagatttgcatcttgttagcactagaggaaatgctatagattc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28675046 |
ccatgtaaagaagaaggtatctgcaaaaacctttggatcaagattttcttgctcgttcagatttgcatcttgttagcactagaggaaatgctatagattc |
28675145 |
T |
 |
| Q |
225 |
tc |
226 |
Q |
| |
|
|| |
|
|
| T |
28675146 |
tc |
28675147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University