View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_low_54 (Length: 315)
Name: NF1150_low_54
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 53 - 282
Target Start/End: Complemental strand, 26506823 - 26506597
Alignment:
| Q |
53 |
gatcaagatccaccaatattatagcaaaatattcaacattgcagctcttagttcgttagctattgtgggatcgttgtatatttattgatacataattcat |
152 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26506823 |
gatcaagatccaccaatattctagcaaaatattcaaccttgaagctattagttcgttagctattgtgggatcgttgtatatttattgatacataattcat |
26506724 |
T |
|
| Q |
153 |
cacttgtgttggtcggcatttctgttcattatcagtcgtgatgaggttcaagttctcatggttaataattagcaaaaatgtctttgaggagctgttttgt |
252 |
Q |
| |
|
|| |||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26506723 |
catttgtgttggtcgacatttctgtccattatcagtcgtgatgaggttcaagttctcatggt---taattagcaaaaatgtctttgaggagctgttttgt |
26506627 |
T |
|
| Q |
253 |
tgtgtttgatgtagtggttaatagatgaaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26506626 |
tgtgtttgatgtagtggttaatagatgaaa |
26506597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 221 - 282
Target Start/End: Original strand, 37336067 - 37336128
Alignment:
| Q |
221 |
ttagcaaaaatgtctttgaggagctgttttgttgtgtttgatgtagtggttaatagatgaaa |
282 |
Q |
| |
|
|||| |||| ||||||| ||||||||||||| |||||||| ||||||| ||||||| ||||| |
|
|
| T |
37336067 |
ttagtaaaattgtctttaaggagctgttttggtgtgtttgttgtagtgattaatagttgaaa |
37336128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University