View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_low_55 (Length: 315)
Name: NF1150_low_55
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_low_55 |
 |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0032 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 37 - 315
Target Start/End: Complemental strand, 32206 - 31931
Alignment:
| Q |
37 |
cttaatttatcaaacttctttaatgtgttttagaaatttaagatgtagttaatctttgtaatcgtgaagtagtagagtaagaatcaagattagaaacata |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32206 |
cttaatttatcaaacttctttaatgtgttttagaaatttaagatgtagttaatctttgtaatcgtgaagtag---agtaagaatcaagattagaaacata |
32110 |
T |
 |
| Q |
137 |
aaggagggcaaggatttagtttgctacaatatagatccaagttgagataattgatatcataattgatcgtgttttgtagaatggttagattgcttttatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32109 |
aaggagggcaaggatttagtttgctacagtatagatccaagttgagataattgatatcataattgatcgtgttttgtagaatggttagattgcttttgtt |
32010 |
T |
 |
| Q |
237 |
ttgtgatactgttcattttgagagtggacttggatttggaaggtgcttgggttgcaagtctctaaatacttaataagaa |
315 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32009 |
ttgtgatactgttcattttgtgagtggacttggattcggaaggtgcttgggttgcaagtctctatatacttaataagaa |
31931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University