View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_low_64 (Length: 298)
Name: NF1150_low_64
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_low_64 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 15052615 - 15052904
Alignment:
| Q |
1 |
caggttgagtgattttgagtgatttaaaattgattcttttagacgattgattttggtgcttaaaaactcgacatcgtaaatatataatgaaaccttgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15052615 |
caggttgagtgattttgagtgatttaaaattgattcttttagacgattgattttggtgcttaaaaactcgacatcgtaaatatataatgaaaccttgaaa |
15052714 |
T |
|
| Q |
101 |
ttttcttcctttcggtggtagatgatgtcggtttgactaagatgaatttaatatgatgaaatgaattagagatcagatgactgcttcactacacttcgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15052715 |
ttttcttcctttcggtggtagatgatgtcggtttgactaagatgaatttaatatgatgaaatgaattagagatcagatgactgcttcactacacttcgtg |
15052814 |
T |
|
| Q |
201 |
ataggtggtgacatctccaagaacccgttttgtgccctagatgatgtgaacttgatggtactttttctggatcggtcaaaggcctatgct |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15052815 |
ataggtggtgacatctccaagaacccgttttgtgccctagatgatgtgaacttgatggtactttttctggatcggtcaaaggcttatgct |
15052904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University