View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_low_66 (Length: 295)
Name: NF1150_low_66
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_low_66 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 7675708 - 7675468
Alignment:
| Q |
1 |
agttgggtatcctctacgcacaattacataaactaatctctcgaaccagataagacagtagtggatgacaaaactctctaccaaccatctcattcaagta |
100 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7675708 |
agttgggtattctctacacacaattacataaactaatctctcgaaccggataagacagtagtggatgacaaaactctctaccaaccatctcattcaagta |
7675609 |
T |
|
| Q |
101 |
ctcttgaaaggcacgattgattgtgacttaagcgtgctcaggatatgagttgatgaggaagatgacataacatatttggtatgcaaagggacacaattgt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7675608 |
ctcttgaaaggcacgactgattgtgacttaagcgtgctcaggatatgagttgatgaggaagatgacataacatatttggtatgcaaagggacacaattgt |
7675509 |
T |
|
| Q |
201 |
tgctgtatatcacattgaaactatggaccatctgttctgtg |
241 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7675508 |
tgttgtatatcacattaaaactatggaccatctgttctgtg |
7675468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University