View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1150_low_73 (Length: 248)

Name: NF1150_low_73
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1150_low_73
NF1150_low_73
[»] chr1 (1 HSPs)
chr1 (9-248)||(46942025-46942264)


Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 9 - 248
Target Start/End: Original strand, 46942025 - 46942264
Alignment:
9 agcataggatggacttctgcttccatacatgtggggtggggaaggatacggtggaagagcagctgggtattgcccgtgtgatggagatctaacaaatgta 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
46942025 agcataggatggacttctgcttccatacatgtggggtggggaaggatacagtggaagagcagctgggtattgcccgtgtgatggagatctaacaaatgta 46942124  T
109 ggagcggcagggaaagatgatacatatgcattagtcaaacgtccagctttagcaggtggcattggacctccattgctgttgcttgctcgtgttcttttat 208  Q
    | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46942125 gaagcggcagggaaagatgatacatatgcattggtcaaacgtccagctttagcaggtggcattggacctccattgctgttgcttgctcgtgttcttttat 46942224  T
209 tggcagggaccacaatctgttttctcttctcaggcttaac 248  Q
    |||||||||| ||||||||||| || ||||||||||||||    
46942225 tggcagggacaacaatctgtttccttttctcaggcttaac 46942264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University