View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1150_low_80 (Length: 213)

Name: NF1150_low_80
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1150_low_80
NF1150_low_80
[»] chr8 (1 HSPs)
chr8 (107-189)||(39793435-39793517)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 107 - 189
Target Start/End: Original strand, 39793435 - 39793517
Alignment:
107 ccctgcaacaggtttgtttctacttcccnnnnnnnggggactgagcaaaacaaaagataccatcatacgaagtggtaggttgc 189  Q
    ||||||||||||||||||||||||| ||        ||||||||||| ||| |||||||||||||||||||||||||||||||    
39793435 ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgc 39793517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University