View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_low_83 (Length: 207)
Name: NF1150_low_83
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_low_83 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 44 - 188
Target Start/End: Original strand, 53038206 - 53038350
Alignment:
| Q |
44 |
gatcggttttcaatgttatcacccatgtctnnnnnnngtaaacggccattttgagtcttaaccaaaatgctcattttgtggactggtaccacctcttcta |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53038206 |
gatcggttttcaatgttatcacccatgtctaaaaaaagtaaacaaccattttgagtcttaaccaaaatgctcattttgtggactggtaccacctcttcta |
53038305 |
T |
|
| Q |
144 |
ataagagttggaatgaaatacatgaacatttgtcgaagtcccaga |
188 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
53038306 |
ataagagttggaatcaaatacatgaacatttgtcgaagtcccaga |
53038350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University