View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1150_low_85 (Length: 205)
Name: NF1150_low_85
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1150_low_85 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 23 - 194
Target Start/End: Complemental strand, 6026345 - 6026174
Alignment:
| Q |
23 |
aatacaatattcaaggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataagccccaaatggcttgttatgct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
6026345 |
aatacaatattcaaggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataatccccaaatggcttgttctgct |
6026246 |
T |
|
| Q |
123 |
tggtacttgagtagcttcacatggaaaacaaccataacatttatgctcacagcttggtggacttgaccctat |
194 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6026245 |
tggcacttgagtagcttcacatggaaaacaatcatagcatttatgctcacagcttggtggacttgaccctat |
6026174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 37 - 110
Target Start/End: Complemental strand, 42824335 - 42824262
Alignment:
| Q |
37 |
ggactatagaatgaaggaccacacttgcatttccaactctcaggctcataatttgcatacataagccccaaatg |
110 |
Q |
| |
|
||||| ||||| ||||||||||| ||||||||||| || ||||||||||||||||||||| ||| |||||||| |
|
|
| T |
42824335 |
ggactgtagaaggaaggaccacatttgcatttccagctttcaggctcataatttgcatactgaagacccaaatg |
42824262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 194
Target Start/End: Complemental strand, 42824239 - 42824166
Alignment:
| Q |
121 |
cttggtacttgagtagcttcacatggaaaacaaccataacatttatgctcacagcttggtggacttgaccctat |
194 |
Q |
| |
|
||||| |||||| | |||||||||||| || |||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
42824239 |
cttggaacttgaatggcttcacatggattgcatccataacacttgtgctcacagcttggtggacttgaccctat |
42824166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University