View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1150_low_88 (Length: 201)

Name: NF1150_low_88
Description: NF1150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1150_low_88
NF1150_low_88
[»] chr4 (1 HSPs)
chr4 (1-117)||(21640992-21641108)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 21640992 - 21641108
Alignment:
1 gtatctcgtgtaaccttgttttgctgaagaagcaaaggctttgattgattgttttctctcttataatttatcttataacaaacctatattcattaatgta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||    
21640992 gtatctcgtgtaaccttgttttgctgaagaagcaaaggctttgattgattgttttctctcttataatttatcttttaacaaacctatactcattaatgta 21641091  T
101 cgtatgatcactttcat 117  Q
    |||||||||||||||||    
21641092 cgtatgatcactttcat 21641108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University