View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11510_low_4 (Length: 275)
Name: NF11510_low_4
Description: NF11510
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11510_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 19 - 177
Target Start/End: Original strand, 13610305 - 13610463
Alignment:
| Q |
19 |
tcaggaagtctcaattttctttcaagtgaattggggtatctacattggcataaatatcctttcacttgtttgccatcaagttttgagccggataaacttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
13610305 |
tcaggaagtctcaattttctttcaagtgaattggggtatctatattgggaaaaatatcctttcacatgtttgccatcaagttttcagccggataaacttg |
13610404 |
T |
|
| Q |
119 |
ttgaactgatcttacctcatagcaacatcaggcaactatgggtggacacaaaggtacta |
177 |
Q |
| |
|
||||| ||||| ||| | |||||||||||||||||||||| || |||||||||||| |
|
|
| T |
13610405 |
ttgaattgatcctacgttctagcaacatcaggcaactatggaagggaacaaaggtacta |
13610463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 19 - 174
Target Start/End: Original strand, 31246251 - 31246406
Alignment:
| Q |
19 |
tcaggaagtctcaattttctttcaagtgaattggggtatctacattggcataaatatcctttcacttgtttgccatcaagttttgagccggataaacttg |
118 |
Q |
| |
|
||||||||||||||||||||||| ||| | ||||||||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31246251 |
tcaggaagtctcaattttctttctagtcatttggggtatctctgttgggataaatatcctttcacttgtttgccatcaagtttccagccggataaacttg |
31246350 |
T |
|
| Q |
119 |
ttgaactgatcttacctcatagcaacatcaggcaactatgggtggacacaaaggta |
174 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||| || |||||||||| |
|
|
| T |
31246351 |
ttgaactggtcctacctcgtagcaacatcaggcaactatgggagggcacaaaggta |
31246406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University