View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11511_high_14 (Length: 354)
Name: NF11511_high_14
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11511_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 180 - 342
Target Start/End: Original strand, 18110477 - 18110639
Alignment:
| Q |
180 |
cttatgagtcaagcaagaatcaaaacttagaagaaaaggaagttgaaaaagcagaaccttctgctccaaatgttccagagaaggaaaaggaatcttgctg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110477 |
cttatgagtcaagcaagaatcaaaacttagaagaaaaggaagttgaaaaagcagaaccttctgctccaaatgttccagagaaggaaaaggaatcttgctg |
18110576 |
T |
 |
| Q |
280 |
cagaattcctccaaatcaagaaggaaagaatggaatcagaaaatttgctgctacttcatctca |
342 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18110577 |
cagaattcctcccaatcaagaaggaaagaatggaatcagaaaatttgctgctacttcttctca |
18110639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 18 - 118
Target Start/End: Original strand, 18110315 - 18110415
Alignment:
| Q |
18 |
atgaaaaggctcaaaagggtgaagaggaagtagaaccaaaaacaatagagaaattggttaccaaagaaaatttagaggaaaagatagtaggaatgagtgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18110315 |
atgaaaaggctcaaaagggtgaagaggaagtagaaccaaaaacaatagagaaattggttaccaaagaaaatttagaggaaaagatagtaggaatgagtgc |
18110414 |
T |
 |
| Q |
118 |
t |
118 |
Q |
| |
|
| |
|
|
| T |
18110415 |
t |
18110415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University