View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11511_high_17 (Length: 336)
Name: NF11511_high_17
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11511_high_17 |
 |  |
|
| [»] scaffold1034 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 324
Target Start/End: Original strand, 7242140 - 7242432
Alignment:
| Q |
18 |
gttggagcctctggagaccttgccaagaagaagatatttccagcactttttgcactttactatgaggattgtctgcctaaggttggatattgatatatag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7242140 |
gttggagcctctggagaccttgccaagaagaagatatttccagcactttttgcactttactatgagggttgtctgcctaaggttggatattgatatatag |
7242239 |
T |
 |
| Q |
118 |
ttgtcttgtttttgttttgtatattttggaaattggttatgtgtatgtatttgggattgaaatgtttatttatttcatggcagcacttcaccatttgtgg |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7242240 |
ttgtcttgttttt--------------ggaaattggttatgtgtatgtatttgggattgaactgtttatttatttcatggcagcacttcaccatttgtgg |
7242325 |
T |
 |
| Q |
218 |
ttatgctcgaagtaagatgactgatgcagaactgagaaatatggtcagcaagactcttacctgtagaattgataagaggtaaatatatctccaacttgtt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7242326 |
ttatgctcgaagtaagatgactgatgcagaactgagaaatatggtcagcaagactcttacctgtagaattgataagaggtaaatatatctccaacttgtt |
7242425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1034 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold1034
Description:
Target: scaffold1034; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 448 - 378
Alignment:
| Q |
18 |
gttggagcctctggagaccttgccaagaagaagatatttccagcactttttgcactttactatgaggattg |
88 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
448 |
gttggagcatctggagaccttgccaaaaagaagatttttccagcactttttgctcttttctatgaagattg |
378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University