View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11511_high_20 (Length: 282)

Name: NF11511_high_20
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11511_high_20
NF11511_high_20
[»] chr1 (1 HSPs)
chr1 (13-282)||(44333209-44333478)


Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 13 - 282
Target Start/End: Complemental strand, 44333478 - 44333209
Alignment:
13 agcaaagggattcaggaaagttcgtgaggttgaaggaggaggaacatggtggtgatgagaaagaggaagaagcttcaggatcacatggattgaaccaaca 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44333478 agcaaagggattcaggaaagttcgtgaggttgaaggaggaggaacatggtggtgatgagaaagaggaagaagcttcaggatcacatggattgaaccaaca 44333379  T
113 gcagtatggggaggtggcaatgtcttgtcctatggtttcagcgccgactcagcatggattgggccaggcccaaaatgagtgggtccaagtccaacaagga 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44333378 gcagtatggggaggtggcaatgtcttgtcctatggtttcagcgccgactcagcatggattgggccaggcccaaaatgagtgggtccaagtccaacaagga 44333279  T
213 agtggttattttccaatgatgtcaggttttgtccctgtctcttctagttctaattctcctcgtctgtatt 282  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
44333278 agtggctattttccaatgatgtcaggttttgtccctgtctcttctagttctaattctcctcgtatgtatt 44333209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University