View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11511_high_26 (Length: 235)

Name: NF11511_high_26
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11511_high_26
NF11511_high_26
[»] chr6 (1 HSPs)
chr6 (13-220)||(59231-59438)
[»] chr7 (1 HSPs)
chr7 (14-220)||(8689756-8689962)
[»] chr2 (1 HSPs)
chr2 (14-220)||(41388335-41388541)
[»] scaffold0015 (1 HSPs)
scaffold0015 (14-113)||(68371-68470)
[»] chr3 (1 HSPs)
chr3 (106-220)||(43647098-43647212)


Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 59438 - 59231
Alignment:
13 atgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
59438 atgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatg 59339  T
113 ggcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatgagaccac 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
59338 ggcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatgagaccac 59239  T
213 ttacaact 220  Q
    ||||||||    
59238 ttacaact 59231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 8689756 - 8689962
Alignment:
14 tgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatgg 113  Q
    |||| ||||||||  | ||||||||||||||||||||||||||||| |||||| ||| |||||||||  | || ||||||||||| || |||||||||||    
8689756 tgaaagaaaagctttcatacattgcccttgactatgagcaagagctggagacagccaggaccagctcatccgtcgagaagagctacgaattgcctgatgg 8689855  T
114 gcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatgagaccact 213  Q
     || || ||||| || || |  |||||||| || |||||||||||| | | ||||||||| ||| | ||||||||||| ||||| ||||| ||||||||     
8689856 acaggtgatcaccatcggagacgagcgtttcagatgtccagaggtcctgttccaaccatctatgataggaatggaagcagcaggcattcacgagaccaca 8689955  T
214 tacaact 220  Q
    |||||||    
8689956 tacaact 8689962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 41388335 - 41388541
Alignment:
14 tgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatgg 113  Q
    |||||||||||||| |||| ||||||||||| | |||||||||||| || || || || || || ||||| || ||||||||||||||| | ||||||||    
41388335 tgaaggaaaagctgtcttatattgcccttgattttgagcaagagcttgaaacttcaaaaacaagttctgctgttgagaagagctatgagcttcctgatgg 41388434  T
114 gcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatgagaccact 213  Q
     ||  | ||||||||||| |||||||||||  | ||||| |||||  | | ||| || |||||||| |||||||||||||  |||||||| ||||| ||     
41388435 acagataatcactattggtgctgagcgtttccgttgtcctgaggttcttttccagccttccatggttggaatggaagctgttggaattcacgagacgaca 41388534  T
214 tacaact 220  Q
    |||||||    
41388535 tacaact 41388541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 113
Target Start/End: Original strand, 68371 - 68470
Alignment:
14 tgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatgg 113  Q
    |||||||||| ||  | |||||||| ||||| ||||| |||||| |||| || || ||||| ||||| || || ||||||||||||||||| ||||||||    
68371 tgaaggaaaaactatcctacattgctcttgattatgaacaagagttagaaacctcgaagacgagctcagctgttgagaagagctatgagttacctgatgg 68470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 220
Target Start/End: Complemental strand, 43647212 - 43647098
Alignment:
106 cctgatgggcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatg 205  Q
    |||||||| ||||| ||||| ||||| |||||| | ||  | || ||||| ||| | | ||||||||| ||| | |||||||||||||| |||||||| |    
43647212 cctgatggacaagttatcacaattggagctgagaggttccgttgcccagaagtccttttccaaccatcaatgatcggaatggaagctgctggaattcacg 43647113  T
206 agaccacttacaact 220  Q
    ||||||| |||||||    
43647112 agaccacctacaact 43647098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University