View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11511_high_26 (Length: 235)
Name: NF11511_high_26
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11511_high_26 |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 59438 - 59231
Alignment:
| Q |
13 |
atgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59438 |
atgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatg |
59339 |
T |
 |
| Q |
113 |
ggcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatgagaccac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
59338 |
ggcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatgagaccac |
59239 |
T |
 |
| Q |
213 |
ttacaact |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
59238 |
ttacaact |
59231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 8689756 - 8689962
Alignment:
| Q |
14 |
tgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatgg |
113 |
Q |
| |
|
|||| |||||||| | ||||||||||||||||||||||||||||| |||||| ||| ||||||||| | || ||||||||||| || ||||||||||| |
|
|
| T |
8689756 |
tgaaagaaaagctttcatacattgcccttgactatgagcaagagctggagacagccaggaccagctcatccgtcgagaagagctacgaattgcctgatgg |
8689855 |
T |
 |
| Q |
114 |
gcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatgagaccact |
213 |
Q |
| |
|
|| || ||||| || || | |||||||| || |||||||||||| | | ||||||||| ||| | ||||||||||| ||||| ||||| |||||||| |
|
|
| T |
8689856 |
acaggtgatcaccatcggagacgagcgtttcagatgtccagaggtcctgttccaaccatctatgataggaatggaagcagcaggcattcacgagaccaca |
8689955 |
T |
 |
| Q |
214 |
tacaact |
220 |
Q |
| |
|
||||||| |
|
|
| T |
8689956 |
tacaact |
8689962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 14 - 220
Target Start/End: Original strand, 41388335 - 41388541
Alignment:
| Q |
14 |
tgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatgg |
113 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| | |||||||||||| || || || || || || ||||| || ||||||||||||||| | |||||||| |
|
|
| T |
41388335 |
tgaaggaaaagctgtcttatattgcccttgattttgagcaagagcttgaaacttcaaaaacaagttctgctgttgagaagagctatgagcttcctgatgg |
41388434 |
T |
 |
| Q |
114 |
gcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatgagaccact |
213 |
Q |
| |
|
|| | ||||||||||| ||||||||||| | ||||| ||||| | | ||| || |||||||| ||||||||||||| |||||||| ||||| || |
|
|
| T |
41388435 |
acagataatcactattggtgctgagcgtttccgttgtcctgaggttcttttccagccttccatggttggaatggaagctgttggaattcacgagacgaca |
41388534 |
T |
 |
| Q |
214 |
tacaact |
220 |
Q |
| |
|
||||||| |
|
|
| T |
41388535 |
tacaact |
41388541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 14 - 113
Target Start/End: Original strand, 68371 - 68470
Alignment:
| Q |
14 |
tgaaggaaaagctggcttacattgcccttgactatgagcaagagctagagacatccaagaccagctctgcagtggagaagagctatgagttgcctgatgg |
113 |
Q |
| |
|
|||||||||| || | |||||||| ||||| ||||| |||||| |||| || || ||||| ||||| || || ||||||||||||||||| |||||||| |
|
|
| T |
68371 |
tgaaggaaaaactatcctacattgctcttgattatgaacaagagttagaaacctcgaagacgagctcagctgttgagaagagctatgagttacctgatgg |
68470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 220
Target Start/End: Complemental strand, 43647212 - 43647098
Alignment:
| Q |
106 |
cctgatgggcaagtcatcactattggcgctgagcgttttaggtgtccagaggtcttataccaaccatccatggtgggaatggaagctgcaggaattcatg |
205 |
Q |
| |
|
|||||||| ||||| ||||| ||||| |||||| | || | || ||||| ||| | | ||||||||| ||| | |||||||||||||| |||||||| | |
|
|
| T |
43647212 |
cctgatggacaagttatcacaattggagctgagaggttccgttgcccagaagtccttttccaaccatcaatgatcggaatggaagctgctggaattcacg |
43647113 |
T |
 |
| Q |
206 |
agaccacttacaact |
220 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
43647112 |
agaccacctacaact |
43647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University