View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11511_high_27 (Length: 233)
Name: NF11511_high_27
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11511_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 33824662 - 33824460
Alignment:
| Q |
13 |
agaagaagaacacgtagttacacttattactgatattgggtttgaattgcaccattggtagttggaagatcagaccaagtaagggttggaattggattcc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33824662 |
agaaaaagaacacgtagttacacttattactgatattgggtttgaattgcaccattggtagttggaagatcagaccaagtaagggttggaattggattcc |
33824563 |
T |
 |
| Q |
113 |
agtaccctaattcaccaccagtaactgaagttgtctccaaaatgttggatatagacgaagaatttgaagccgcgttccctagtaataccgttggtgaaga |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33824562 |
agtaccctaattcaccaccagtaactgaagttgtctccaaaatgttggatatagacgaagaatttgaagccgcgttccctagtaataccgttggtgaaga |
33824463 |
T |
 |
| Q |
213 |
tga |
215 |
Q |
| |
|
||| |
|
|
| T |
33824462 |
tga |
33824460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University