View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11511_high_27 (Length: 233)

Name: NF11511_high_27
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11511_high_27
NF11511_high_27
[»] chr8 (1 HSPs)
chr8 (13-215)||(33824460-33824662)


Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 33824662 - 33824460
Alignment:
13 agaagaagaacacgtagttacacttattactgatattgggtttgaattgcaccattggtagttggaagatcagaccaagtaagggttggaattggattcc 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33824662 agaaaaagaacacgtagttacacttattactgatattgggtttgaattgcaccattggtagttggaagatcagaccaagtaagggttggaattggattcc 33824563  T
113 agtaccctaattcaccaccagtaactgaagttgtctccaaaatgttggatatagacgaagaatttgaagccgcgttccctagtaataccgttggtgaaga 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33824562 agtaccctaattcaccaccagtaactgaagttgtctccaaaatgttggatatagacgaagaatttgaagccgcgttccctagtaataccgttggtgaaga 33824463  T
213 tga 215  Q
    |||    
33824462 tga 33824460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University