View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11511_low_16 (Length: 353)
Name: NF11511_low_16
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11511_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 346
Target Start/End: Complemental strand, 6878682 - 6878337
Alignment:
| Q |
1 |
cctctttcgcccaccgtccccttagcttcgcctttaccttcattcttaatctgcccggtagcatctcgtataaggcctcacgtgcgtcctctccaactgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878682 |
cctctttcgcccaccgtccccttagcttcgcctttaccttcattcttaatcttcccggtagcatctcgtataaggcctcacgtgcgtcctctccaactgt |
6878583 |
T |
 |
| Q |
101 |
cgcgggcgcatggagacaacgctccgccagtaggatcagattagcataccttaaagcaagcccaactccacccactgttgatggcggggcgagctttaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878582 |
cgcgggcgcatggagacaacgctccgccagtaggatcaaattagcatacctcaaagcaagcccaactccacccactgttgatggcggggcgagctttaaa |
6878483 |
T |
 |
| Q |
201 |
accttatcatgcttaccattcatcattttctcagttccgtcacgaccagaagcaaaatccattggcataggattgttgagaaacctgatcacattaggtt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6878482 |
accttatcatgcttaccattcatcattttctcagttccgtcacgaccagaagcaaaatccattggcataggattgttgagaaacctgatcacattaggtt |
6878383 |
T |
 |
| Q |
301 |
tcgttgctactttggaaatcggccctgacttcaccacgcgtttctg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
6878382 |
tcgttgctactttggaaatcggccctgactttaccacgcgcttctg |
6878337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University