View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11511_low_23 (Length: 260)
Name: NF11511_low_23
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11511_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 40762584 - 40762355
Alignment:
| Q |
18 |
ttatgtgctgtttttggggctaaataatcacttaatcttaatttgtttcatgattttcaaacagcaggaaagcccagcgaactggtgtgtattctattca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762584 |
ttatgtgctgtttttggggctaaataatcacttaatcttaatttgtttcatgattttcaaacagcaggaaagcccagcgaactggtgtgtattctattca |
40762485 |
T |
|
| Q |
118 |
cttttgatacaacactcatttactttgtttgaatattgttcttgtagtatgtcttcaatttacaatataatataatataatttctttcatatgtttacag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40762484 |
cttttgatacaacactcatttactttgtttgaatattgttcttctagtatgtcttcaatttacaatataata-----taatttctttcatatgtttacag |
40762390 |
T |
|
| Q |
218 |
cctagggccccaagcaaactttctgctttcttctc |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762389 |
cctagggccccaagcaaactttctgctttcttctc |
40762355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University