View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11511_low_26 (Length: 241)
Name: NF11511_low_26
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11511_low_26 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 91 - 241
Target Start/End: Original strand, 7422863 - 7423012
Alignment:
| Q |
91 |
gacttcgacattggcaatattagcagcactagcaccatcgccatcgccatcaccaccgtcaccatcattcaatcattacgtaagggtagaacagtgggcc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7422863 |
gacttcgacattggcaatattagcagcactagcaccatcaccatcgccatcaccaccgtcaccatcattcaatcattacg-aagggtagaacagtgggcc |
7422961 |
T |
 |
| Q |
191 |
ttgggtgtttgcaaggatccaaaaatcaaatgcatatccaccacactcccc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7422962 |
ttgggtgtttgcaaggatccaaaaatcaaatgcatatccaccacactcccc |
7423012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University