View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11511_low_30 (Length: 221)
Name: NF11511_low_30
Description: NF11511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11511_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 30104026 - 30103822
Alignment:
| Q |
1 |
tttaaagagatggtttagttcttatcacgcggcattgcttttgttttattccttgacttggtattcagaatattcagccaaagtggttgattgaattaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30104026 |
tttaaagagatggtttagttcttatcacgcggcatggcttttgttttattacttgacttggtattcagaatattcagccaaagtggttgattgaattaga |
30103927 |
T |
 |
| Q |
101 |
cacattatttt-aaatattaatgaccaggacggttaataatattgaaatactaatgatatttaatataatgaaaagtttgttacttactgatctagtgtg |
199 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30103926 |
cacattattttcaaatattaatgaccaggacggttaataatattgaaataataatgatatttaatataatgaaaagtttgttacttactgatctagtgtg |
30103827 |
T |
 |
| Q |
200 |
acttc |
204 |
Q |
| |
|
||||| |
|
|
| T |
30103826 |
acttc |
30103822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University