View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11513_high_5 (Length: 242)
Name: NF11513_high_5
Description: NF11513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11513_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 37850471 - 37850251
Alignment:
| Q |
18 |
aaagggtcggttttcagattctgaggttgcaaggtggtgctgttttctcgtccttgagtttgtctataaacggaagaagcgatgatgtagatcatagata |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37850471 |
aaagggtcggttttcagattctgagggtgcaaggtggtgctgttttctcttccttgagtttgtctataaacggaagaagcgatgatgtagatcatagata |
37850372 |
T |
 |
| Q |
118 |
caaatccaatcaaaaagaagagaaggagaatattcaggttcatggatcgggtgctgtcaacatgaccaaacacctctggtctggtgcttttgccgctatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37850371 |
caaatccaatcaaaaagaagagaaggagaatattcatgttcatggatcgggtgctgtcaacatgaccaaacacctctggtctggtgcttttgccgctatg |
37850272 |
T |
 |
| Q |
218 |
gtctcaaggtctctgcttctc |
238 |
Q |
| |
|
|||||||||||| | |||||| |
|
|
| T |
37850271 |
gtctcaaggtctttacttctc |
37850251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University