View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11513_high_6 (Length: 228)

Name: NF11513_high_6
Description: NF11513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11513_high_6
NF11513_high_6
[»] chr7 (1 HSPs)
chr7 (53-87)||(19113225-19113259)


Alignment Details
Target: chr7 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 53 - 87
Target Start/End: Complemental strand, 19113259 - 19113225
Alignment:
53 gggtggtggttccactgattctaaccatactggta 87  Q
    |||||||||||||||||||||||||||||||||||    
19113259 gggtggtggttccactgattctaaccatactggta 19113225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University