View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_high_17 (Length: 407)
Name: NF11514_high_17
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 344; Significance: 0; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 20 - 394
Target Start/End: Complemental strand, 32191138 - 32190755
Alignment:
| Q |
20 |
ccagcaaccttagcaagaccatcacctaacccatgatgtccacct---------tcagacttttccgcatcattacctttgtgatgatccggtttggaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191138 |
ccagcaaccttagcaagaccatcacctaacccatgatgtccacctcctccaccttcagacttttccgcatcattacctttgtgatgatccggtttggaag |
32191039 |
T |
 |
| Q |
111 |
aaggtggaggtgtcgtggccgcatcatgacctttgggatgataaccatgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatc |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191038 |
aaggtggagcagtcgtggccgcatcatgacctttgggatgataaccatgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatc |
32190939 |
T |
 |
| Q |
211 |
caatttagcatactgaccaaccgcatcaagaagatctcctgcagcctccgccaccttcgccttgtccatcggcttttgatctgcagagcctttccccaaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190938 |
caatttagcatactgaccaaccgcatcaagaagatctcctgcagcctccgccaccttcgccttgtccatcggcttttgatctgcagagcctttccccaaa |
32190839 |
T |
 |
| Q |
311 |
cttgattgtgctgcctctgctacaatttttgcactcgccataagctcgctggttgaaatcttcttctcttccccatggctccct |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32190838 |
cttgattgtgctgcctctgctacaatttttgcactcgccataagctcgctggttgaaatcttcttctcttccccatggctccct |
32190755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 157 - 255
Target Start/End: Complemental strand, 32210367 - 32210269
Alignment:
| Q |
157 |
atgcagataatcagcagccttatcaacatactgtcctaaccccttctgatcatccaatttagcatactgaccaaccgcatcaagaagatctcctgcagc |
255 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||||| |||||||| || ||||| |
|
|
| T |
32210367 |
atgcagataatcagcagctttatcaacatatgatcctacacctttctgatcatccaatttagcatactgaccaactgcatctagaagatcaccagcagc |
32210269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 300 - 381
Target Start/End: Complemental strand, 32210242 - 32210161
Alignment:
| Q |
300 |
ctttccccaaacttgattgtgctgcctctgctacaatttttgcactcgccataagctcgctggttgaaatcttcttctcttc |
381 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||| | |||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
32210242 |
ctttcccaaaacctgactgtgctgcctctgctactacctttgcacttgccattagctcactggttgaaatcttcttctcttc |
32210161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University