View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_high_21 (Length: 362)
Name: NF11514_high_21
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 143 - 347
Target Start/End: Complemental strand, 27154052 - 27153848
Alignment:
| Q |
143 |
ttgttggtttttgcaaaatcttaataactagtcctataatctctctgtgttgtatggtttcttaattttaggtaaaaagagagacatagatagannnnnn |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27154052 |
ttgttggtttttgcaaaatcttaataactaatcctataatctctctgtgttgtatggtttcttaattttaggtaaaaagagagacatagatagattttgt |
27153953 |
T |
|
| Q |
243 |
nnnnnnnnnnnnngtgtgtgattagattcttgctatgtttctttgggttcgttaacaggacaagtgttattcttctccttcaatcttggtttgccgcgca |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27153952 |
ttttacgttttttgtgtgtgattagattcttgctatgtttctttgggttcgttaacaggacaagtgttattcttctccttcaatcttggtttgccgcgca |
27153853 |
T |
|
| Q |
343 |
ttttt |
347 |
Q |
| |
|
||||| |
|
|
| T |
27153852 |
ttttt |
27153848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 6 - 114
Target Start/End: Complemental strand, 27154189 - 27154081
Alignment:
| Q |
6 |
cggacgttggattattggtcgaactgcgcaagttctgccgtaaacagaacagaattgccagctcagatggaatagaaatagattttgtttgttcttctcg |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27154189 |
cggacattggattattggtcgaactgcgcaagttctgccgtaaacagaacagaattgccagctcagatggaatagaaatagattttgtttgttcttctcg |
27154090 |
T |
|
| Q |
106 |
gaatgcaac |
114 |
Q |
| |
|
||||||||| |
|
|
| T |
27154089 |
gaatgcaac |
27154081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University