View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_high_26 (Length: 303)
Name: NF11514_high_26
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 11 - 287
Target Start/End: Complemental strand, 48882738 - 48882462
Alignment:
| Q |
11 |
cacagatgttattgttgatttttctgaatctaagagtaacgttgctattctacgtaatgatgcagcttatccttacccaaccggtgatccagttgatgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48882738 |
cacagatgttattgttgatttttctgaatctaagagtaacgttgctattctacgtaatgatgcagcttatccttacccaaccggtgatccagttgatgaa |
48882639 |
T |
 |
| Q |
111 |
actagtggtaaggttatgaaatttgtaattttaccggataaagaagttgacacgtcaaggataccggaaaagcttgtggaatatcaggttgttgatttat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48882638 |
actagtggtaaggttatgaaatttgtaattttaccggataaagaagttgacacgtcaaggataccggaaaagcttgtggaatatccggttgttgatttat |
48882539 |
T |
 |
| Q |
211 |
caagtgtgacgcaaacacggtatattgctatgtatgagtacacgagtgatattgatgaaccgattcacttgtatttc |
287 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48882538 |
caagtgtgacggaaacacggtatattgctatgtatgagtacacgagtgatattgatgaaccgattcacttgtatttc |
48882462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University