View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_high_28 (Length: 297)
Name: NF11514_high_28
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 100 - 279
Target Start/End: Complemental strand, 10748055 - 10747875
Alignment:
| Q |
100 |
ctgacttaactagaggtcttctgtttctattcaactctggatatgcatcaacattaaaactctcgaaaggaaagagctttgtcgttcattatagtcata- |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10748055 |
ctgacttaactagaggtcttctgtttctattcaactctggatatgaatcaacattaaaactcta-aaaggaaagagctttgtcgttcattatagtcataa |
10747957 |
T |
 |
| Q |
199 |
-ccctgatctatgaaatagtctttgtagttacgtgtggaagatacccgatttactgagaaagaaaagacagaaaaccagatc |
279 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||| ||||| |
|
|
| T |
10747956 |
accctgatctatgaagtagtctttgtagttacatgtggaagatacccgatttagtgagaaagaaaagaaagaaaactagatc |
10747875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 15 - 84
Target Start/End: Complemental strand, 10748115 - 10748046
Alignment:
| Q |
15 |
agagacaaaaaagaatgacaattacaaaagaacggttgtgtgaaatggttctcgtcgcttctgacttaac |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10748115 |
agagacaaaaaagaatgacaattacaaaagaacggttgtatgaaatggttctcgtcgcttctgacttaac |
10748046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University