View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_high_35 (Length: 253)
Name: NF11514_high_35
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_high_35 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 41341031 - 41340795
Alignment:
| Q |
17 |
caagtttgtactttatttctttttattaataaattttgagtgctaataaatgataggtaattgttttggtgtgtcaacatagnnnnnnnnnaaagaaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41341031 |
caagtttgtactttatttctttttattaataaattttgagtgctaataaatgatagataattgttttggtgtgtcaacatagtttttttttaaagaaaga |
41340932 |
T |
|
| Q |
117 |
ttggtgtgtcaacatagttggaatgtcgtagtagtcacatggtatttttgcactctaattgcttgnnnnnnngatgtcacaattttgactcaacaacaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
41340931 |
ttggtgtgtcaacatagttggaatgtcgtagtcgtcacatggtatttttgcactctaattgcttgaaaaaaagatgacacaattttgactcaacaacaaa |
41340832 |
T |
|
| Q |
217 |
caatgtggaatcatcatcgttgttagtttggcaattc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41340831 |
caatgtggaatcatcatcgttgttagtttggcaattc |
41340795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University