View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11514_high_41 (Length: 248)

Name: NF11514_high_41
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11514_high_41
NF11514_high_41
[»] chr2 (1 HSPs)
chr2 (41-137)||(3823509-3823605)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 41 - 137
Target Start/End: Original strand, 3823509 - 3823605
Alignment:
41 tgcagttttgagcatggatgttaacattgaagagtgagattttagaggttgaggtgaaatagtgccatacaaaacagcgccaccacctcctctgtag 137  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3823509 tgcagttttgagcatggatgttaacattgaagagtgagatttgagaggttgaggtgaaatagtgccatacaaaacagcgccaccacctcctctgtag 3823605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University