View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_high_41 (Length: 248)
Name: NF11514_high_41
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 41 - 137
Target Start/End: Original strand, 3823509 - 3823605
Alignment:
| Q |
41 |
tgcagttttgagcatggatgttaacattgaagagtgagattttagaggttgaggtgaaatagtgccatacaaaacagcgccaccacctcctctgtag |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3823509 |
tgcagttttgagcatggatgttaacattgaagagtgagatttgagaggttgaggtgaaatagtgccatacaaaacagcgccaccacctcctctgtag |
3823605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University