View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11514_high_46 (Length: 238)

Name: NF11514_high_46
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11514_high_46
NF11514_high_46
[»] chr2 (1 HSPs)
chr2 (150-215)||(40464099-40464164)


Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 150 - 215
Target Start/End: Original strand, 40464099 - 40464164
Alignment:
150 ggttatatttttagtctataatagaccatcaaaatttaccaacacatatatgaccaataatattta 215  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
40464099 ggttatatttttagtctataatagaccatcaaaatttaccaaaacatatatgaccaataatattta 40464164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University