View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11514_high_48 (Length: 222)
Name: NF11514_high_48
Description: NF11514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11514_high_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 5 - 195
Target Start/End: Original strand, 567455 - 567641
Alignment:
| Q |
5 |
gcaacagctgctgcatgcgcaaaacttgctttggagtgcatagtctttatggctgctaaagacatggacagacaatcatctaatgtacggttgatgaagc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
567455 |
gcaacagctgctgcatgcgcaaaacttgctttggagtgcacagtctttatggctgcgaaagacatggacagacaatcatctaatgtacggttgatgaagc |
567554 |
T |
 |
| Q |
105 |
tgttaggagctaaggtaaccaatcaaacataacctttaattttaattaattattcaacacgaagattttcctacctaaatgaatccaataa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
567555 |
tgttaggagctaaggtaaccaatcaaacataacctttaatt----ttaattattgaacacgaagattttcctacctaaaagaatccaataa |
567641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University